glra4b

Ensembl ID:
ENSDARG00000058103
ZFIN ID:
ZDB-GENE-020402-2
Description:
Glycine receptor, alpha 4b [Source:UniProtKB/TrEMBL;Acc:A2BGE6]
Human Orthologue:
GLRA4
Human Description:
glycine receptor, alpha 4 [Source:HGNC Symbol;Acc:31715]
Mouse Orthologue:
Glra4
Mouse Description:
glycine receptor, alpha 4 subunit Gene [Source:MGI Symbol;Acc:MGI:95750]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13378 Essential Splice Site Available for shipment Available now
sa13466 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 237 537 5 10
ENSDART00000006474 Essential Splice Site 237 537 5 10
Genomic Location:
Chromosome 5 (position 24316706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGTTAGAGAGCTG[T/A]AAGACTCAACATCAACAACTCATTTAAATATCATTTCTTCTTTGTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 237 537 5 10
ENSDART00000006474 Essential Splice Site 237 537 5 10
Genomic Location:
Chromosome 5 (position 24316706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGTTAGAGAGCTG[T/A]AAGACTCAACATCAACAACTCATTTAAATATCATTTCTTCTTTGTATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j8l1llfy