glra4b

Ensembl ID:
ENSDARG00000058103
ZFIN ID:
ZDB-GENE-020402-2
Description:
Glycine receptor, alpha 4b [Source:UniProtKB/TrEMBL;Acc:A2BGE6]
Human Orthologue:
GLRA4
Human Description:
glycine receptor, alpha 4 [Source:HGNC Symbol;Acc:31715]
Mouse Orthologue:
Glra4
Mouse Description:
glycine receptor, alpha 4 subunit Gene [Source:MGI Symbol;Acc:MGI:95750]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30615 Essential Splice Site Mutation detected in F1 DNA During 2015
sa13378 Essential Splice Site Available for shipment Available now
sa13466 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 69 537 1 10
Genomic Location:
Chromosome 5 (position 24327273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTACTGGAGCTCTTACTGGTTTGCTGGATGTTTGAAGGGGTCATCAGG[T/G]GAGTTTTCATCAAGTCTCTGTGTTTTTGTTGGTTAAAACACTATGCGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 237 537 5 10
ENSDART00000006474 Essential Splice Site 237 537 5 10
Genomic Location:
Chromosome 5 (position 24316706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGTTAGAGAGCTG[T/A]AAGACTCAACATCAACAACTCATTTAAATATCATTTCTTCTTTGTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 237 537 5 10
ENSDART00000006474 Essential Splice Site 237 537 5 10
Genomic Location:
Chromosome 5 (position 24316706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGTTAGAGAGCTG[T/A]AAGACTCAACATCAACAACTCATTTAAATATCATTTCTTCTTTGTATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j8l1llfy