glra4b

Ensembl ID:
ENSDARG00000058103
ZFIN ID:
ZDB-GENE-020402-2
Description:
Glycine receptor, alpha 4b [Source:UniProtKB/TrEMBL;Acc:A2BGE6]
Human Orthologue:
GLRA4
Human Description:
glycine receptor, alpha 4 [Source:HGNC Symbol;Acc:31715]
Mouse Orthologue:
Glra4
Mouse Description:
glycine receptor, alpha 4 subunit Gene [Source:MGI Symbol;Acc:MGI:95750]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30615 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40407 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40406 Nonsense Mutation detected in F1 DNA During 2016
sa13378 Essential Splice Site Available for shipment Available now
sa13466 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 69 537 1 10
Genomic Location (Zv9):
Chromosome 5 (position 24327273)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22040145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTACTGGAGCTCTTACTGGTTTGCTGGATGTTTGAAGGGGTCATCAGG[T/G]GAGTTTTCATCAAGTCTCTGTGTTTTTGTTGGTTAAAACACTATGCGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 209 537 4 10
Genomic Location (Zv9):
Chromosome 5 (position 24316874)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22029746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCTGCTGAGAATTTTCCAGAACGGAAACGTGCTGTATAGCATCAGG[T/C]GCAGTGTCAGCCCCTACAGTATATGTTACATAAATCCTTTCAAACTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Nonsense 234 537 5 10
Genomic Location (Zv9):
Chromosome 5 (position 24316716)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22029588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGATCTGAAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGT[T/A]AGAGAGCTGTAAGACTCAACATCAACAACTCATTTAAATATCATTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 237 537 5 10
ENSDART00000006474 Essential Splice Site 237 537 5 10
Genomic Location (Zv9):
Chromosome 5 (position 24316706)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22029578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGTTAGAGAGCTG[T/A]AAGACTCAACATCAACAACTCATTTAAATATCATTTCTTCTTTGTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006474 Essential Splice Site 237 537 5 10
ENSDART00000006474 Essential Splice Site 237 537 5 10
Genomic Location (Zv9):
Chromosome 5 (position 24316706)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22029578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTCCCAATGGACACTCAGACCTGCACTATGCAGTTAGAGAGCTG[T/A]AAGACTCAACATCAACAACTCATTTAAATATCATTTCTTCTTTGTATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link