sardh

Ensembl ID:
ENSDARG00000058102
ZFIN ID:
ZDB-GENE-040426-996
Description:
sarcosine dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_957422]
Human Orthologue:
SARDH
Human Description:
sarcosine dehydrogenase [Source:HGNC Symbol;Acc:10536]
Mouse Orthologue:
Sardh
Mouse Description:
sarcosine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2183102]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21675 Essential Splice Site Available for shipment Available now
sa18270 Splice Site, Nonsense Available for shipment Available now
sa34856 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34857 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080904 Essential Splice Site 269 924 5 22
ENSDART00000129253 Essential Splice Site 269 682 5 17
ENSDART00000131043 Essential Splice Site 269 924 4 21
Genomic Location (Zv9):
Chromosome 10 (position 10364131)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10439997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACTCCTCATGGCACCATCCGAACACCATGTGTGGTCAATTGTGCAGG[T/A]AAGGATGAGGCTGATTTCCCCAGCAGAGGGCAGTGTTTGATCATGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080904 Nonsense 519 924 13 22
ENSDART00000129253 Splice Site None 682 None 17
ENSDART00000131043 Nonsense 519 924 12 21
Genomic Location (Zv9):
Chromosome 10 (position 10457363)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10533229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTTAAACTTGTGTTTTCTTTGTACTTTTCCTCAGGTTCTAGATTA[T/G]GATTACTATGGTGCATATAATGTTCCCAAGAACACGGTTTACAAATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080904 Essential Splice Site 637 924 15 22
ENSDART00000129253 Essential Splice Site 551 682 13 17
ENSDART00000131043 Essential Splice Site 637 924 14 21
Genomic Location (Zv9):
Chromosome 10 (position 10460566)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10536432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCTGGAGCCAAGCCCCTCCCACCTCCCACTGACACCCGAATTTAATG[G/A]TAACCAACACACATTATTCATCCCATTCAGGGTCACACTACTGATGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080904 Nonsense 895 924 21 22
ENSDART00000129253 Nonsense 653 682 16 17
ENSDART00000131043 Nonsense 895 924 20 21
Genomic Location (Zv9):
Chromosome 10 (position 10526973)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10602839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTGCGCAGTGGAGATTTCACTCTGGAACGGATGGGCGTTACATAC[A/T]AGGCCACAGCCCACCTGAAGTCTCCCTTCGACCCTGAAAACAAGCGCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link