rprd2

Ensembl ID:
ENSDARG00000058089
ZFIN ID:
ZDB-GENE-030131-6641
Description:
regulation of nuclear pre-mRNA domain containing 2 [Source:RefSeq peptide;Acc:NP_956216]
Human Orthologue:
RPRD2
Human Description:
regulation of nuclear pre-mRNA domain containing 2 [Source:HGNC Symbol;Acc:29039]
Mouse Orthologue:
Rprd2
Mouse Description:
regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43223 Nonsense Mutation detected in F1 DNA During 2017
sa32233 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080897 Nonsense 581 1113 10 10
Genomic Location (Zv9):
Chromosome 19 (position 9518991)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8977530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAAACAACCCAGCTGCAAAGACCCCTACAAATTCAAATTCTGAAAAG[C/T]AATCCCTGACCACGCCTGTTACAGAAGAATCTCATACACCTCCTAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080897 Nonsense 803 1113 10 10
Genomic Location (Zv9):
Chromosome 19 (position 9518325)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8976864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCTAGAAGCCACTGAAAGATCCAGTATGCTGCTTCAAGATATGAGA[C/T]AAAACCCTCTAATCCATAATGTGGCACCAAATCCTAAACTAGCGGAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link