pdcd8

Ensembl ID:
ENSDARG00000058088
ZFIN ID:
ZDB-GENE-030826-11
Description:
apoptosis-inducing factor 1, mitochondrial [Source:RefSeq peptide;Acc:NP_956396]
Human Orthologue:
AIFM1
Human Description:
apoptosis-inducing factor, mitochondrion-associated, 1 [Source:HGNC Symbol;Acc:8768]
Mouse Orthologue:
Aifm1
Mouse Description:
apoptosis-inducing factor, mitochondrion-associated 1 Gene [Source:MGI Symbol;Acc:MGI:1349419]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1710 Essential Splice Site, Missense Confirmed mutation in F2 line During 2017
sa33579 Nonsense Mutation detected in F1 DNA During 2017
sa40408 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1710
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080882   None 613 None 16
ENSDART00000080886 Essential Splice Site 241 750 6 19
ENSDART00000131889 Missense 242 750 6 19
ENSDART00000147513   None 263 None 7
Genomic Location (Zv9):
Chromosome 5 (position 24347848)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22060720
KASP Assay ID:
554-1656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTCAGCACCGAGCATGTTCCAGAGGCTTCATCTGTTTCTGAGAGTG[G/A]TAAGAGTCCAGGTTTCACTGGATGGGAATCAGTTCTGCAGATTAAACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080882 Nonsense 334 613 10 16
ENSDART00000080886 Nonsense 471 750 13 19
ENSDART00000131889 Nonsense 471 750 13 19
ENSDART00000147513   None 263 None 7
Genomic Location (Zv9):
Chromosome 5 (position 24338698)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22051570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTATTATTATTTTCTCTGTAGCTGCTGACCCTGGTTTAGAGGTGATG[C/T]AGCTCTTCCCAGAGAAGGGTAACATGGGAAAAGTGCTGCCTGAATACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080882 Nonsense 430 613 12 16
ENSDART00000080886 Nonsense 567 750 15 19
ENSDART00000131889 Nonsense 567 750 15 19
ENSDART00000147513   None 263 None 7
Genomic Location (Zv9):
Chromosome 5 (position 24336738)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22049610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGAAGTGGACTCTGATTTCGGAGGCTATCGGGTTAATGCTGAGCTC[C/T]AGGCTCGCTCTAACATCTGGGTGGTACGTAAGGCTATATTAGGGGGGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link