birc7

Ensembl ID:
ENSDARG00000058082
ZFIN ID:
ZDB-GENE-070615-35
Description:
baculoviral IAP repeat-containing 7 [Source:RefSeq peptide;Acc:NP_001092238]
Human Orthologue:
BIRC7
Human Description:
baculoviral IAP repeat-containing 7 [Source:HGNC Symbol;Acc:13702]
Mouse Orthologue:
Birc7
Mouse Description:
baculoviral IAP repeat-containing 7 (livin) Gene [Source:MGI Symbol;Acc:MGI:2676458]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10528 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080894 Nonsense 36 309 1 5
ENSDART00000129794 Nonsense 36 404 1 7
ENSDART00000143618 Nonsense 56 329 1 5
Genomic Location:
Chromosome 23 (position 14329687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTCGGGATGCGCAGTGAGGAGGAGAGGCTCCAGACCTTCCACAACTG[G/A]CCCARCGACGCTGCAGTGAGTCCAGAGGAGCTCGCACGGGCTGGCTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wnrj7vnw