magt1

Ensembl ID:
ENSDARG00000058062
ZFIN ID:
ZDB-GENE-030131-3667
Description:
Magnesium transporter protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV50]
Human Orthologue:
MAGT1
Human Description:
magnesium transporter 1 [Source:HGNC Symbol;Acc:28880]
Mouse Orthologue:
Magt1
Mouse Description:
magnesium transporter 1 Gene [Source:MGI Symbol;Acc:MGI:1914325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31974 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080864 Nonsense 83 328 2 10
ENSDART00000106641 Nonsense 83 328 2 10
ENSDART00000131343 Nonsense 47 131 2 4

The following transcripts of ENSDARG00000058062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 12645754)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12081527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATCGTCATGTTCACAGCTCTTCAGCCACAGAGACAGTGTGGAGTCTG[C/A]AGGTAAGTGTATGGACAAAGAACATATAACTTTTTTTTCTCCTGTAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link