pafah1b3

Ensembl ID:
ENSDARG00000058047
ZFIN ID:
ZDB-GENE-040426-1026
Description:
platelet-activating factor acetylhydrolase IB subunit gamma [Source:RefSeq peptide;Acc:NP_957352]
Human Orthologue:
PAFAH1B3
Human Description:
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) [Source:HGNC Symbol;Acc:8
Mouse Orthologue:
Pafah1b3
Mouse Description:
platelet-activating factor acetylhydrolase, isoform 1b, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:10

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9090 Nonsense Mutation detected in F1 DNA During 2017
sa42671 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060145 Nonsense 35 221 3 6
ENSDART00000134793 Nonsense 35 209 3 9
ENSDART00000136329 Nonsense 35 78 3 4
ENSDART00000141101 Nonsense 35 221 4 7

The following transcripts of ENSDARG00000058047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 13528563)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11887654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ANNNNNNNNNNTAATAACATTGTCTTGTCTTTGCAGCACAATCGATTTGTATCAGACAGT[A/T]AAGGAAAAGAGCCYGAWGTTCTGTTTGTTGGAGATTCACTCATCCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060145 Nonsense 38 221 3 6
ENSDART00000134793 Nonsense 38 209 3 9
ENSDART00000136329 Nonsense 38 78 3 4
ENSDART00000141101 Nonsense 38 221 4 7

The following transcripts of ENSDARG00000058047 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 13528554)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11887645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTGTCTTTGCAGCACAATCGATTTGTATCAGACAGTAAAGGAAAA[G/T]AGCCTGATGTTCTGTTTGTTGGAGATTCACTCATCCAGCTTCTGCATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link