tlr21

Ensembl ID:
ENSDARG00000058045
ZFIN ID:
ZDB-GENE-040220-4
Description:
Toll-like receptor 21 [Source:UniProtKB/TrEMBL;Acc:B0S591]
Mouse Orthologue:
Tlr13
Mouse Description:
toll-like receptor 13 Gene [Source:MGI Symbol;Acc:MGI:3045213]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13264 Nonsense Available for shipment Available now
sa32073 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060142 Nonsense 778 989 1 1
Genomic Location (Zv9):
Chromosome 16 (position 13536699)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11895790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTATGTCAAACTTTACTGGAAATTMAAGTDTGGCTACTATGTGTTT[C/T]RATCGYGGTTTGGAGARCAGTGGCGTCGCTTACGGGACCAGGAGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060142 Nonsense 933 989 1 1
Genomic Location (Zv9):
Chromosome 16 (position 13536232)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11895323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCTGGGTCAAACTGTTCTGATCCAAACAGTGCAAAAGAACTGTTCTG[G/A]AATCAGTTAAAGAGAGCTCTAAGAAGCAGCAACTCTGGAAGCCAAGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link