bhlhe22

Ensembl ID:
ENSDARG00000058039
ZFIN ID:
ZDB-GENE-040426-1411
Description:
class E basic helix-loop-helix protein 22 [Source:RefSeq peptide;Acc:NP_957249]
Human Orthologue:
BHLHE22
Human Description:
basic helix-loop-helix family, member e22 [Source:HGNC Symbol;Acc:11963]
Mouse Orthologue:
Bhlhe22
Mouse Description:
basic helix-loop-helix family, member e22 Gene [Source:MGI Symbol;Acc:MGI:1930001]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30103 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080840 Nonsense 147 238 1 1
ENSDART00000147658 Nonsense 170 261 1 1
Genomic Location (Zv9):
Chromosome 24 (position 25070210)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24317088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCGCGGTCATCCCTTACGCGCACAGTCCGTCTGTACGGAAACTCTCC[A/T]AAATCGCCACCTTGCTCTTAGCCAAAAATTACATCCTCATGCAGGCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link