LOC100332533

Ensembl ID:
ENSDARG00000058038
Human Orthologue:
EML3
Human Description:
echinoderm microtubule associated protein like 3 [Source:HGNC Symbol;Acc:26666]
Mouse Orthologue:
Eml3
Mouse Description:
echinoderm microtubule associated protein like 3 Gene [Source:MGI Symbol;Acc:MGI:2387612]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20885 Nonsense Mutation detected in F1 DNA During 2016
sa20886 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14586 Nonsense Available for shipment Available now
sa20887 Essential Splice Site Available for shipment Available now
sa40853 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17294 Essential Splice Site Available for shipment Available now
sa9328 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18865 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Nonsense 57 976 2 24
Genomic Location (Zv9):
Chromosome 7 (position 19107933)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17609316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCCTCATTGGCCGATGCTTTACGCAGGCTCCGCCTCCATGACCAA[C/T]AGATACCCCTGCTTAAACAGCAGCTGATTGCTGGTATGAGCTTTCTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Essential Splice Site 68 976 2 24
ENSDART00000080834 Essential Splice Site 68 976 2 24
Genomic Location (Zv9):
Chromosome 7 (position 19107968)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17609351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTCCATGACCAACAGATACCCCTGCTTAAACAGCAGCTGATTGCTGG[T/G]ATGAGCTTTCTTGCTGTTTTTACAGTGTGCTACTGTACAGATATCACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Nonsense 384 976 9 24
Genomic Location (Zv9):
Chromosome 7 (position 19127599)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17628982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCATCTGGAGAAGCAGTTTATTTTATTGCATGTGTGRTGGTTCTGTA[T/G]CATATCAGCAACCAAAAGCAAAGACATTATCGGAAGCACACAGAYTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Essential Splice Site 463 976 11 24
Genomic Location (Zv9):
Chromosome 7 (position 19129299)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17630682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGGCATATTTGAGCGAGGTGTCGGAGCCATAGCATTTTCCAATTCAG[T/A]GAGTTTTGCCTTCAATTTTGCATTCTTTCCTGCTGAAACGCGACACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Essential Splice Site 637 976 15 24
Genomic Location (Zv9):
Chromosome 7 (position 19139499)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17640882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGATCATCCGCTGGAGTGCAGACCTGGCGCCTGAAAGAGAGTGTGAGG[T/C]AAACCATGAGTCTGTGAGAATTGTGCGTTTATAGCTCTGTATAGGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Essential Splice Site 638 976 16 24
Genomic Location (Zv9):
Chromosome 7 (position 19139620)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17641003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTGTATAGCTTGTAAYCAGAAACWTTCTGAATGCTCTATGTTCTTCCA[G/T]ATTCCTGAGAAATTTKGAGCWGTGCGCACCATTGCAGATTTAGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Essential Splice Site 775 976 19 24
ENSDART00000080834 Essential Splice Site 775 976 19 24
Genomic Location (Zv9):
Chromosome 7 (position 19141771)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17643154
KASP Assay ID:
2259-8591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTGATTGACGGCAATGAACAGTTGTCTGTAATGAGATACTCACCAG[G/T]TCAGARTTCAACAAGATCATTGTGCAATCAWAATAATAATATAATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080834 Essential Splice Site 775 976 19 24
ENSDART00000080834 Essential Splice Site 775 976 19 24
Genomic Location (Zv9):
Chromosome 7 (position 19141771)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17643154
KASP Assay ID:
2259-8591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTGATTGACGGCAATGAACAGTTGTCTGTAATGAGATACTCACCAG[G/T]TCAGAGTTCAACAAGATCATTGTGCAATCAAAATAATAATATAATACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link