fbxw9

Ensembl ID:
ENSDARG00000058020
ZFIN ID:
ZDB-GENE-091204-198
Human Orthologue:
FBXW9
Human Description:
F-box and WD repeat domain containing 9 [Source:HGNC Symbol;Acc:28136]
Mouse Orthologue:
Fbxw9
Mouse Description:
F-box and WD-40 domain protein 9 Gene [Source:MGI Symbol;Acc:MGI:1915878]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19955 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080807 None None 390 None 7
ENSDART00000137678 Essential Splice Site 29 485 3 9
Genomic Location:
Chromosome 3 (position 13261042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTTTAGCGTGACTGTGGACATTTGTATTGTGATCTTTCACCCCACA[G/T]TTTGCATTGTGAGCCGTCCGTCATCGCCACAGACACAAGCCCCTCCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080807 Nonsense 335 390 5 7
ENSDART00000137678 Nonsense 430 485 6 9
Genomic Location:
Chromosome 3 (position 13255942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACACTTCACTGGTCACCGGCGTTCACTACACCCCTGGCGCTCTCTA[C/A]ACCTGCTCATCCGACCGCTCCATCAAGGTCAGTCAGKCATTAGTTYATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x4k53yk0