hgd

Ensembl ID:
ENSDARG00000058005
ZFIN ID:
ZDB-GENE-020802-5
Description:
homogentisate 1,2-dioxygenase [Source:RefSeq peptide;Acc:NP_694498]
Human Orthologue:
HGD
Human Description:
homogentisate 1,2-dioxygenase [Source:HGNC Symbol;Acc:4892]
Mouse Orthologue:
Hgd
Mouse Description:
homogentisate 1, 2-dioxygenase Gene [Source:MGI Symbol;Acc:MGI:96078]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9565 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080487 Essential Splice Site 29 443 2 13
ENSDART00000121938 Essential Splice Site 29 393 2 14
Genomic Location:
Chromosome 24 (position 24568915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTCCTCTGAAGACCCTCRCTGTCCAGGATCTCTACCTGAGGGACAGG[T/C]AGTGCCAAAACTTCACCTTCACCGTCTTCTTCCTGACCAATTAACAMGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s68gcq6t