tmf1

Ensembl ID:
ENSDARG00000057997
ZFIN ID:
ZDB-GENE-040801-25
Description:
TATA element modulatory factor [Source:RefSeq peptide;Acc:NP_001003522]
Human Orthologue:
TMF1
Human Description:
TATA element modulatory factor 1 [Source:HGNC Symbol;Acc:11870]
Mouse Orthologue:
Tmf1
Mouse Description:
TATA element modulatory factor 1 Gene [Source:MGI Symbol;Acc:MGI:2684999]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14896 Essential Splice Site Available for shipment Available now
sa5841 Nonsense Mutation detected in F1 DNA During 2014
sa9263 Nonsense Mutation detected in F1 DNA During 2014
sa12876 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080770 Essential Splice Site 45 1135 1 17
Genomic Location:
Chromosome 11 (position 18281941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATTAAAGAAGAGGAGTGGGGTGACAYAACMGGACAGAACTTCCCTGG[T/C]AAGTTTAAGTAKGAATGGKGTAAKTTGAGTGRAAAAANGAAGATGGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080770 Nonsense 336 1135 2 17
Genomic Location:
Chromosome 11 (position 18278336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCTCTCCGCTTCAACATGCAGCGACTTCCCTCGYCTGGATGAATA[T/A]CCCAAACTCACTGAAAGCTGCGGCTCCTCATCTGATGCTTTTGAGCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080770 Nonsense 500 1135 3 17
Genomic Location:
Chromosome 11 (position 18274474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATTATTGAGGAGCTCTCTGGCMGATTGGAAAAGAGAGAATCACAGT[T/A]GCTTGCGGTCAGTAAAGACAAGGCYAGRCYTGAGGAGGAGTGTGACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080770 Essential Splice Site 1088 1135 16 17
Genomic Location:
Chromosome 11 (position 18262613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGAGAGTAAAGTGAAGGAAATCCCTAGGCTGAAAGTGCAACTGAAGG[T/C]GAACCACDTGCAAATCTACTAACAGATTANNNCAACTTGTTATCTTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n7vzeaau