arl15b

Ensembl ID:
ENSDARG00000057995
ZFIN ID:
ZDB-GENE-080813-2
Description:
Arl15b protein [Source:UniProtKB/TrEMBL;Acc:Q4V9M5]
Human Orthologue:
ARL15
Human Description:
ADP-ribosylation factor-like 15 [Source:HGNC Symbol;Acc:25945]
Mouse Orthologue:
Arl15
Mouse Description:
ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6162 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080781 Nonsense 170 246 4 5
ENSDART00000140095 Nonsense 116 142 4 4

The following transcripts of ENSDARG00000057995 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 9127936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCGGAGGAGGATCTGGAGGTGGCGCGTACWGAGCTCCACYCGGCCCTG[C/T]AGCATCCGCAGCTCTGCACACTTCCCTTCCTCATTTTGGCTAACCACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiponectin levels: A genome-wide association study reveals variants in ARL15 that influence adiponectin levels. (View Study)
  • Adiponectin levels: Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6kqfalqv