fstb

Ensembl ID:
ENSDARG00000057992
ZFIN IDs:
ZDB-GENE-031118-139, ZDB-GENE-031118-139
Description:
follistatin b isoform 1 [Source:RefSeq peptide;Acc:NP_001034720]
Human Orthologue:
FST
Human Description:
follistatin [Source:HGNC Symbol;Acc:3971]
Mouse Orthologue:
Fst
Mouse Description:
follistatin Gene [Source:MGI Symbol;Acc:MGI:95586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7644 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080772 Nonsense 149 344 3 6
ENSDART00000110443 Nonsense 149 319 3 5
Genomic Location:
Chromosome 10 (position 9060001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCTCSGATGGGAAAACAWACCGGAATGAGTGTGCCCTCCTTAGGRCC[A/T]AGTGCAAAAGGCACCCTGACCTGTCTGCGCAGTACCAGGGAAAATGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0crny5g5