uba3

Ensembl ID:
ENSDARG00000057987
ZFIN ID:
ZDB-GENE-040426-2825
Description:
NEDD8-activating enzyme E1 catalytic subunit [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVX6]
Human Orthologue:
UBA3
Human Description:
ubiquitin-like modifier activating enzyme 3 [Source:HGNC Symbol;Acc:12470]
Mouse Orthologue:
Uba3
Mouse Description:
ubiquitin-like modifier activating enzyme 3 Gene [Source:MGI Symbol;Acc:MGI:1341217]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13986 Nonsense Available for shipment Available now
sa21878 Nonsense Mutation detected in F1 DNA During 2014
sa9776 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080752 Nonsense 251 462 10 18
Genomic Location:
Chromosome 11 (position 18292720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCACTATAGCGTCTATGCCACGGTTACCCGAACATTGTGTTGAAWA[T/G]GTACGCATGYTGCTGTGGCCCAAAGAAAAGCCCTTTGGAGGTACAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080752 Nonsense 326 462 13 18
Genomic Location:
Chromosome 11 (position 18288913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAATACTATTTGCTTTTTTTCCTGCATGTTTCAGCTGCTTGCGCCACA[G/T]AGGTTTTCAAAATTGCCACAAGGTAAGTTATAATATAGTTCTTTAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080752 Essential Splice Site 433 462 17 18
Genomic Location:
Chromosome 11 (position 18286987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATCTATTGAAGAAAGAACACGACCTAATCTGAGCAAAACACTGAAAG[G/A]TGAATTAAAGTTCTTTCCTGGTTAATAAANNNATATCTCATTTTATAGKTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3sktq3zz