ints8

Ensembl ID:
ENSDARG00000057986
ZFIN ID:
ZDB-GENE-050522-556
Description:
integrator complex subunit 8 [Source:RefSeq peptide;Acc:NP_001018592]
Human Orthologue:
INTS8
Human Description:
integrator complex subunit 8 [Source:HGNC Symbol;Acc:26048]
Mouse Orthologue:
Ints8
Mouse Description:
integrator complex subunit 8 Gene [Source:MGI Symbol;Acc:MGI:1919906]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43260 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23502 Nonsense Available for shipment Available now
sa23501 Essential Splice Site Available for shipment Available now
sa11804 Nonsense Available for shipment Available now
sa23500 Nonsense Available for shipment Available now
sa23499 Nonsense Available for shipment Available now
sa6551 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751 Essential Splice Site 102 217 4 18
ENSDART00000104491 Essential Splice Site 102 996 4 28
ENSDART00000126298   None 109 None 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19966567)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18519702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTCTTGTCATGTGAAAGTTCTTTTTGTCTTTCTGTTTGTATTGCA[G/A]TTTAACCATCCCTGTGCTCAATATGTTATTGAATGAACTTCTCTGTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751 Nonsense 213 217 7 18
ENSDART00000104491 Nonsense 213 996 7 28
ENSDART00000126298   None 109 None 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19961096)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18514231
KASP Assay ID:
2261-3199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTATCGTGGTTTTAGAAGGAGCCCTGAGCATCAAAAAAGACTTCTA[T/G]ATCCACACACTTCGAACCTTAGACTTGCTAGCTGCAGATCCCAGTACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751   None 217 None 18
ENSDART00000104491 Essential Splice Site 287 996 None 28
ENSDART00000126298 Essential Splice Site 54 109 None 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19960760)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18513895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAGCAAGAGAACATTTCAGGAAAGCACGCGAACTGCTTACAAAGG[T/A]GAGATATGAAATAAATGAAAGTTCAACCAAAAATTGACTCTTCAGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751   None 217 None 18
ENSDART00000104491 Nonsense 338 996 9 28
ENSDART00000126298 Nonsense 105 109 3 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19960113)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18513248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACACCCCATATGGCCAGATCAGTTGCTTCATGAGGAACCACAATTA[T/A]GGGGTAGGCAAGATGTAAGCAAAATGTGTATGTATAGCGAGAATGTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751   None 217 None 18
ENSDART00000104491 Nonsense 690 996 17 28
ENSDART00000126298   None 109 None 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19853141)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18406276
KASP Assay ID:
2261-3195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTATCTGACTCTACAGGTGCCCCAGTCACTTGTCAACAACAATCCGTA[T/A]ATAAAGGTATCTGACCAAAATGTCCTAATCACATTTTGTTCTACACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751   None 217 13 18
ENSDART00000104491 Nonsense 865 996 23 28
ENSDART00000126298   None 109 None 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19832346)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18385481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTATTCCACAGCAATGCATTATTACCTTCAGGCTGGGACTGTTTGTT[C/A]GGATTTCTTCACAAAACCAGTTCCTCCAGATGTCTACACTGACCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080751 Essential Splice Site None 217 15 18
ENSDART00000104491 Essential Splice Site 922 996 25 28
ENSDART00000126298   None 109 None 3

The following transcripts of ENSDARG00000057986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19830539)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18383674
KASP Assay ID:
554-4790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAAGTGGACTACATGACTGCATTCAAAGCTCTACAAGAACAAAACAG[G/A]TGAAATTGCAATGCATGTTTTTAAACATATTTGGCTACTGTGTTAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link