
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eps8l1
- Ensembl ID:
- ENSDARG00000057984
- ZFIN ID:
- ZDB-GENE-050306-14
- Description:
- eps8-like1 [Source:RefSeq peptide;Acc:NP_001013331]
- Human Orthologue:
- EPS8L1
- Human Description:
- EPS8-like 1 [Source:HGNC Symbol;Acc:21295]
- Mouse Orthologue:
- Eps8l1
- Mouse Description:
- EPS8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914675]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33123 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40028 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33123
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080749 | Nonsense | 218 | 522 | 9 | 16 |
ENSDART00000133824 | Nonsense | 218 | 246 | 9 | 9 |
ENSDART00000133907 | Nonsense | 205 | 242 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16142535)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16372754 GRCz11 3 16522554 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTAACCGCGCTGTGTGTTTGTTAGCTCTCAGCTCAGCGAGACTGTGCCT[C/T]AGTACACACCTGTCTTTTTGGATGGTTGGCAGCCGATAGCTGTAGACGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40028
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080749 | Essential Splice Site | 272 | 522 | 10 | 16 |
ENSDART00000133824 | None | 246 | None | 9 | |
ENSDART00000133907 | None | 242 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16142292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16372511 GRCz11 3 16522311 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACAGGTAATTGATCAGGCACGTCTGACTGTACACCAGGAGAATGACGG[G/A]TTAGTATGGACAGCTGTGTGTGTGTGTGTATGTGTGTCTATGTTAAGCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: