eps8l1

Ensembl ID:
ENSDARG00000057984
ZFIN ID:
ZDB-GENE-050306-14
Description:
eps8-like1 [Source:RefSeq peptide;Acc:NP_001013331]
Human Orthologue:
EPS8L1
Human Description:
EPS8-like 1 [Source:HGNC Symbol;Acc:21295]
Mouse Orthologue:
Eps8l1
Mouse Description:
EPS8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914675]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33123 Nonsense Mutation detected in F1 DNA During 2017
sa40028 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080749 Nonsense 218 522 9 16
ENSDART00000133824 Nonsense 218 246 9 9
ENSDART00000133907 Nonsense 205 242 8 8
Genomic Location (Zv9):
Chromosome 3 (position 16142535)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16372754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACCGCGCTGTGTGTTTGTTAGCTCTCAGCTCAGCGAGACTGTGCCT[C/T]AGTACACACCTGTCTTTTTGGATGGTTGGCAGCCGATAGCTGTAGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080749 Essential Splice Site 272 522 10 16
ENSDART00000133824   None 246 None 9
ENSDART00000133907   None 242 None 8
Genomic Location (Zv9):
Chromosome 3 (position 16142292)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16372511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGGTAATTGATCAGGCACGTCTGACTGTACACCAGGAGAATGACGG[G/A]TTAGTATGGACAGCTGTGTGTGTGTGTGTATGTGTGTCTATGTTAAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link