plcd4a

Ensembl ID:
ENSDARG00000057975
ZFIN ID:
ZDB-GENE-050208-654
Description:
Novel protein similar to vertebrate phospholipase C delta family [Source:UniProtKB/TrEMBL;Acc:Q1LWH7
Human Orthologue:
PLCD4
Human Description:
phospholipase C, delta 4 [Source:HGNC Symbol;Acc:9062]
Mouse Orthologue:
Plcd4
Mouse Description:
phospholipase C, delta 4 Gene [Source:MGI Symbol;Acc:MGI:107469]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32389 Nonsense Available for shipment Available now
sa24105 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080741 Nonsense 4 761 1 15
ENSDART00000136841   None 743 None 14
Genomic Location (Zv9):
Chromosome 22 (position 12885809)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12721739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTCCCTCTGTATTTAAAATCAGGAGATACCTAAAAAATGACAGAA[C/T]GACAGATGGCTTCTACTGAAAGGAGCCTACGTAAGTTTCATTTAAACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080741 Nonsense 216 761 5 15
ENSDART00000136841 Nonsense 203 743 4 14
Genomic Location (Zv9):
Chromosome 22 (position 12880567)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12716497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGTTTGTGTTGTTTTATAAGATGCTGACTCAGCGCGAGGACATCCTG[C/T]GAGTGTTTCAGGAATATTCAGCCGATGGACAGAAGCTAACGCTCAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link