dph1

Ensembl ID:
ENSDARG00000057973
ZFIN ID:
ZDB-GENE-050417-411
Description:
Diphthamide biosynthesis protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q567W6]
Human Orthologue:
DPH1
Human Description:
DPH1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:3003]
Mouse Orthologue:
Dph1
Mouse Description:
DPH1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2151233]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35893 Nonsense Mutation detected in F1 DNA During 2017
sa1222 Essential Splice Site Available for shipment Available now
sa16246 Essential Splice Site Available for shipment Available now
sa32037 Missense, Nonsense Available for shipment Available now
sa22651 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080740 Nonsense 128 381 4 11
ENSDART00000110408 Nonsense 143 439 4 12
ENSDART00000140214   None 51 None 2
Genomic Location (Zv9):
Chromosome 15 (position 25324719)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26054647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCCCGCGCTTTGGGAGCCGACTTCATGGTGCATTATGGGCACAGCTG[T/A]CTCAGTGAGTCAAACAGAAATGCGCAATCATTATTATGTGCATTTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080740 Essential Splice Site 245 381 7 11
ENSDART00000110408 Essential Splice Site 260 439 7 12
ENSDART00000140214   None 51 None 2
Genomic Location (Zv9):
Chromosome 15 (position 25300510)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26030438
KASP Assay ID:
554-1131.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATTTGGAATCCATCATGATTGCCAACCCAGACACACCTGCCTACAGG[T/C]AAACCAAACCAACGTTTACTACAGCAAGTATCATTATTATCATGGCTTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080740 Essential Splice Site 297 381 8 11
ENSDART00000110408 Essential Splice Site 312 439 8 12
ENSDART00000140214   None 51 None 2
Genomic Location (Zv9):
Chromosome 15 (position 25296798)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26026726
KASP Assay ID:
2260-8552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCATCCTAGGCACCCTTGGTCGTCAGGGCAACCCCAAAATTTTRGAGG[T/C]AAGACCATCTGCTACCTATTGTCCTACAGTATGTTTTTTTNATCAGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080740 Missense 345 381 10 11
ENSDART00000110408 Nonsense 386 439 11 12
ENSDART00000140214 Missense 15 51 1 2
Genomic Location (Zv9):
Chromosome 15 (position 25248963)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25978891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCAGGCAGCAGTGGCGCTACAGCAGGTTGGATGGCAGGATGTGTA[T/A]CCCATGGATTTCTATTCCAATCAGAGTCTGGGGGCCTGGACTCCTAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080740   None 381 11 11
ENSDART00000110408 Nonsense 437 439 12 12
ENSDART00000140214   None 51 2 2
Genomic Location (Zv9):
Chromosome 15 (position 25245766)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25975694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCAGGTGATCAGCTGTGGTCAGGAACAGAGCGCCTCCTGTGGTTGT[C/T]AACCAAAATAACATACAGCCTCATGAACATCTGCCGGAGACAAGCGGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link