si:dkey-18f7.1

Ensembl ID:
ENSDARG00000057946
ZFIN ID:
ZDB-GENE-030131-1599
Description:
synaptonemal complex protein SC65 [Source:RefSeq peptide;Acc:NP_001119910]
Human Orthologue:
LEPREL4
Human Description:
leprecan-like 4 [Source:HGNC Symbol;Acc:16946]
Mouse Orthologue:
1110036O03Rik
Mouse Description:
RIKEN cDNA 1110036O03 gene Gene [Source:MGI Symbol;Acc:MGI:1913430]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3020 Essential Splice Site F2 line generated During 2017
sa36812 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3020
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104451 Essential Splice Site 303 426 4 7
Genomic Location (Zv9):
Chromosome 19 (position 18169195)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19014430
KASP Assay ID:
554-3196.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTGKAGCCACAATGWTCCACTACATGCAGTTTGCTTATTTCAAATG[T/C]AAGTATTACACAAATAAACTCAGACACAGCTACTGTTAATCCTCCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104451 Nonsense 303 426 5 7
Genomic Location (Zv9):
Chromosome 19 (position 18133461)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18978696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTAAAATGATGACCTAATTAATGTATTTTGTTTGTTTGTCCTTTAAG[T/A]AAATGATGTTCGCAATGCAGCATTGTGTGCAGCAACCTATATGCTGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link