dido1

Ensembl ID:
ENSDARG00000057940
ZFIN IDs:
ZDB-GENE-030131-6117, ZDB-GENE-030131-6117, ZDB-GENE-030131-6117
Description:
death inducer-obliterator 1 [Source:RefSeq peptide;Acc:NP_001073424]
Human Orthologue:
DIDO1
Human Description:
death inducer-obliterator 1 [Source:HGNC Symbol;Acc:2680]
Mouse Orthologue:
Dido1
Mouse Description:
death inducer-obliterator 1 Gene [Source:MGI Symbol;Acc:MGI:1344352]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14468 Nonsense Available for shipment Available now
sa10169 Nonsense Available for shipment Available now
sa41807 Nonsense Mutation detected in F1 DNA During 2017
sa41806 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35061 Nonsense Mutation detected in F1 DNA During 2017
sa5842 Nonsense Mutation detected in F1 DNA During 2017
sa35060 Nonsense Mutation detected in F1 DNA During 2017
sa16666 Nonsense Available for shipment Available now
sa8477 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 80 530 3 6
ENSDART00000110882 Nonsense 161 2779 2 15
ENSDART00000122078 Nonsense 161 598 4 8
ENSDART00000125453 Nonsense 161 282 4 4
Genomic Location (Zv9):
Chromosome 11 (position 18971828)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18389142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTTCCGAGGCCAGCTTTGAWGGAAATGCAGAAGCCAAAATAGAGGAA[C/T]AAAAAGTAGCTTCAYCAGAGAAAAAGAAAAGGGGCAGAGGAAGGGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 242 530 3 6
ENSDART00000110882 Nonsense 323 2779 2 15
ENSDART00000122078 Nonsense 323 598 4 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18971340)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18388654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCCAGTGAGTCCGACAGTGATGGGTATGACCCKAATGCACTTTACTG[C/A]ATCTGCAGGCAGAAACACAACAAAAGGTATGTTTCTTTGTGTGCCAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 272 530 4 6
ENSDART00000110882 Nonsense 353 2779 3 15
ENSDART00000122078 Nonsense 353 598 5 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18969856)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18387170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTGATCGTTGTGAGGAGTGGTTTCATGGTGACTGTGTTGGCATTCCT[G/T]AGGCTCGTGGCCGGCTGATGGAGAGAAACGGAGAGGATTATGTCTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950   None 530 None 6
ENSDART00000110882 Essential Splice Site 868 2779 8 15
ENSDART00000122078   None 598 None 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18963112)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18380426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCTATCCAAGGAGCTGTCAGACTGGAGAAAATCTGAGAGCTCTGAGG[T/C]AAAATGAGTTTTGAGTTTGTTGGTGTAAATTTAAATGATTATGTTGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950   None 530 None 6
ENSDART00000110882 Nonsense 1455 2779 15 15
ENSDART00000122078   None 598 None 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18959777)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18377091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAAGAGGTAGTACCAGATGATCGACCGTATGATCCTGAAGAAGAATA[T/A]GATCCGGCCATTGGCTATGATACAGAAAACACACAGGATACAACAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950   None 530 None 6
ENSDART00000110882 Nonsense 2168 2779 15 15
ENSDART00000122078   None 598 None 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18957640)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18374954
KASP Assay ID:
554-3697.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCCAGCCAATACGTTTTAGCTACAAAGATGATACTCCAGGTGACATC[C/T]GAGATGCAAGAGATGTCCGGGACGCAAGAGACATTCGAGACATCCGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950   None 530 None 6
ENSDART00000110882 Nonsense 2324 2779 15 15
ENSDART00000122078   None 598 None 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18957172)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18374486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCCGGGACGCCCGAGATGCAAGAGAAGTTCGAGAGGCAAGAGAAGCT[C/T]GAGACGTGCGAGATGCAAGAGATGTTCGAGACATCCGAGAAGCAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950   None 530 None 6
ENSDART00000110882 Nonsense 2539 2779 15 15
ENSDART00000122078   None 598 None 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18956527)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18373841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCAGAGAGTCMGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCC[G/T]AWCGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950   None 530 None 6
ENSDART00000110882 Nonsense 2664 2779 15 15
ENSDART00000122078   None 598 None 8
ENSDART00000125453   None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18956152)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18373466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACAAATATGGAGAT[G/T]GAGACAAAAGAAGAGACCGGGATCGAGACAGAGAGCGNNNNNNTGGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link