ythdf3

Ensembl ID:
ENSDARG00000057939
ZFIN ID:
ZDB-GENE-030131-6123
Description:
YTH domain family protein 3 [Source:RefSeq peptide;Acc:NP_956164]
Mouse Orthologue:
Ythdf3
Mouse Description:
YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4272 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080837 Nonsense 592 600 4 5
ENSDART00000122294 Nonsense 592 600 4 5
Genomic Location:
Chromosome 24 (position 24897111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACGATTTTGCACATTACGAAAAGCGGCAGGAGGAAGAGGAAGCCATG[C/T]GAAGGGTAAGCGCAGCTTTCTGCCACTCTTCACAATAGCAGAAAGCAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1myx02xc