lhx5

Ensembl ID:
ENSDARG00000057936
ZFIN ID:
ZDB-GENE-980526-484
Description:
LIM/homeobox protein Lhx5 [Source:UniProtKB/Swiss-Prot;Acc:P52889]
Human Orthologue:
LHX5
Human Description:
LIM homeobox 5 [Source:HGNC Symbol;Acc:14216]
Mouse Orthologue:
Lhx5
Mouse Description:
LIM homeobox protein 5 Gene [Source:MGI Symbol;Acc:MGI:107792]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23894 Nonsense Mutation detected in F1 DNA During 2014
sa7954 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19257 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080693 Nonsense 176 399 3 5
Genomic Location:
Chromosome 21 (position 14126132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATCTTCAGATAAAGACACTAACAACAACGAAAACGAGGAGCAAAACT[C/A]GTGCACGAAACGGCGAGGCCCGCGCACCACCATCAAGGCCAAACAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080693 Essential Splice Site 281 399 5 5
ENSDART00000080693 Essential Splice Site 281 399 5 5
Genomic Location:
Chromosome 21 (position 14117074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCAATCTTTGTCTTGAATRCTCCTGATTGAWCTYTGATTTTCTCCCCGC[A/T]GAATACCAAGGTGACTATTACGGCCCAGTGGTCAACTATGATTTCTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080693 Essential Splice Site 281 399 5 5
ENSDART00000080693 Essential Splice Site 281 399 5 5
Genomic Location:
Chromosome 21 (position 14117074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAATCTTTGTCTTGAATACTCCTGATTGAACTTTGATTTTCTCCCCGC[A/T]GAATACCAAGGTGACTATTACGGCCCAGTGGTCAACTATGATTTCTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/evxtyvw0