lhx5

Ensembl ID:
ENSDARG00000057936
ZFIN ID:
ZDB-GENE-980526-484
Description:
LIM/homeobox protein Lhx5 [Source:UniProtKB/Swiss-Prot;Acc:P52889]
Human Orthologue:
LHX5
Human Description:
LIM homeobox 5 [Source:HGNC Symbol;Acc:14216]
Mouse Orthologue:
Lhx5
Mouse Description:
LIM homeobox protein 5 Gene [Source:MGI Symbol;Acc:MGI:107792]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23894 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080693 Nonsense 176 399 3 5
Genomic Location (Zv9):
Chromosome 21 (position 14126132)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15827087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATCTTCAGATAAAGACACTAACAACAACGAAAACGAGGAGCAAAACT[C/A]GTGCACGAAACGGCGAGGCCCGCGCACCACCATCAAGGCCAAACAGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link