rps6ka3b

Ensembl ID:
ENSDARG00000057927
ZFIN ID:
ZDB-GENE-070209-74
Description:
ribosomal protein S6 kinase alpha-3 [Source:RefSeq peptide;Acc:NP_001076495]
Human Orthologues:
RPS6KA3, RPS6KA6
Human Descriptions:
ribosomal protein S6 kinase, 90kDa, polypeptide 3 [Source:HGNC Symbol;Acc:10432]
ribosomal protein S6 kinase, 90kDa, polypeptide 6 [Source:HGNC Symbol;Acc:10435]
Mouse Orthologues:
Rps6ka3, Rps6ka6
Mouse Descriptions:
ribosomal protein S6 kinase polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:104557]
ribosomal protein S6 kinase polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1914321]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24507 Nonsense Available for shipment Available now
sa960 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa24507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066648 Nonsense 108 688 6 22
ENSDART00000130057 Nonsense 139 739 6 22
ENSDART00000135060 Nonsense 139 709 6 21
Genomic Location (Zv9):
Chromosome 24 (position 24818698)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24065576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTACCAGTGAACGCATTCGCTTTTCTCTCACAGCATTCCAGACC[G/T]AAGGAAAGCTTTATCTGATTCTGGACTTCTTAAGAGGAGGCGATCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa960
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066648 Nonsense 348 688 14 22
ENSDART00000130057 Nonsense 379 739 14 22
ENSDART00000135060 Nonsense 379 709 14 21
Genomic Location (Zv9):
Chromosome 24 (position 24802526)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24049404
KASP Assay ID:
554-0865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTNTTTTNNNNNNAGATTCTCCAGGTGTACCTCCTAGTGCCAATGCCAAT[C/T]GACTTTTTAGAGGGTTTAGTTTTGTGGCCATCACTTCAGAAGAAGAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link