ccdc136b

Ensembl ID:
ENSDARG00000057921
ZFIN ID:
ZDB-GENE-081104-244
Human Orthologue:
CCDC136
Human Description:
coiled-coil domain containing 136 [Source:HGNC Symbol;Acc:22225]
Mouse Orthologue:
Ccdc136
Mouse Description:
coiled-coil domain containing 136 Gene [Source:MGI Symbol;Acc:MGI:1918128]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10942 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080679 Nonsense 453 460 8 9
ENSDART00000144175 None None 291 None 6
Genomic Location:
Chromosome 4 (position 9110651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCATACCCTTCATAGGAATGGTTGTAATTTTGGGCCTGATATGGTG[C/A]TGCTGGAAGGAGCTCTTGTCCTAAAGGGGGAAAGGTATGGCTTTGCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q78ybcqr