tsc1b

Ensembl ID:
ENSDARG00000057918
ZFIN ID:
ZDB-GENE-030131-3404
Description:
tuberous sclerosis 1b (tsc1b), non-coding RNA [Source:RefSeq DNA;Acc:NR_023332]
Human Orthologue:
TSC1
Human Description:
tuberous sclerosis 1 [Source:HGNC Symbol;Acc:12362]
Mouse Orthologue:
Tsc1
Mouse Description:
tuberous sclerosis 1 Gene [Source:MGI Symbol;Acc:MGI:1929183]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa916 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080667 Essential Splice Site 402 1228 10 21
ENSDART00000145057 Essential Splice Site 402 1228 11 22
Genomic Location:
Chromosome 21 (position 15834198)
KASP Assay ID:
554-0822.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCATTAAGCTTTAGTGTGAATTGGGTGTTTTGCTGGTTCTCATGCA[G/A]CAGGTGGAAAAGGCACCCCGTCCTCCAKCACGCCTGCAGCTGCAACACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ee2xppob