si:ch73-181d5.4

Ensembl ID:
ENSDARG00000057907
ZFIN ID:
ZDB-GENE-100922-118
Human Orthologue:
DIDO1
Human Description:
death inducer-obliterator 1 [Source:HGNC Symbol;Acc:2680]
Mouse Orthologue:
Dido1
Mouse Description:
death inducer-obliterator 1 Gene [Source:MGI Symbol;Acc:MGI:1344352]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11666 Nonsense Available for shipment Available now
sa24230 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124542 Nonsense 1625 2142 14 14
ENSDART00000135160   None 191 None 2
ENSDART00000140749   None 196 None 4
ENSDART00000147744   None 181 None 3
Genomic Location (Zv9):
Chromosome 23 (position 476981)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 447972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGATAAATCTGCACAGGRCGACACTGGGCAATCAGGAAAGATCGAA[C/T]AGCAGGAGTCTGGAGCATTGCTGGAGGACAGCACTCAATCWGAGCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124542 Nonsense 2005 2142 14 14
ENSDART00000135160   None 191 None 2
ENSDART00000140749   None 196 None 4
ENSDART00000147744   None 181 None 3
Genomic Location (Zv9):
Chromosome 23 (position 475841)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 446832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCGATGCATAGACCATACACACAAAGAGGCCTGCAAAGGTCTGAACTT[C/T]GAGGATTGAGAAGGGGTATTAGAGGGAGGTTTTTTGGAAGGGGTCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link