nme3

Ensembl ID:
ENSDARG00000057904
ZFIN ID:
ZDB-GENE-000210-34
Description:
nucleoside diphosphate kinase 3 [Source:RefSeq peptide;Acc:NP_571003]
Human Orthologue:
NME3
Human Description:
non-metastatic cells 3, protein expressed in [Source:HGNC Symbol;Acc:7851]
Mouse Orthologue:
Nme3
Mouse Description:
non-metastatic cells 3, protein expressed in Gene [Source:MGI Symbol;Acc:MGI:1930182]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33118 Nonsense Mutation detected in F1 DNA During 2017
sa13409 Essential Splice Site Available for shipment Available now
sa33117 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080666 Nonsense 95 169 4 6
ENSDART00000128074   None 115 None 5
ENSDART00000128753 Nonsense 95 169 4 5
ENSDART00000138400   None 180 None 5
ENSDART00000146075   None 169 None 5
Genomic Location (Zv9):
Chromosome 3 (position 15613921)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15844142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCAGTGTTTGCATCTAGAGCCTTCTGTTGTTGTTTTGTTAGGTTTG[G/A]CAGGGGCTGGATGTGGTGAAGACGGCCAGAAAAATGCTTGGAGAGACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080666 Essential Splice Site 131 169 4 6
ENSDART00000128074   None 115 None 5
ENSDART00000128753 Essential Splice Site 131 169 4 5
ENSDART00000138400   None 180 None 5
ENSDART00000146075   None 169 None 5
Genomic Location (Zv9):
Chromosome 3 (position 15613813)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15844034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCCCTGCCAGGCACTATCAGAGGAGACTACTGTGTGGAAGTGGGCAG[G/A]TTAGTGTGTCTGTGCATGCTTTAGATGGATGCATTGAGGATAGAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080666   None 169 None 6
ENSDART00000128074 Nonsense 41 115 4 5
ENSDART00000128753   None 169 None 5
ENSDART00000138400 Nonsense 106 180 4 5
ENSDART00000146075 Nonsense 95 169 4 5
Genomic Location (Zv9):
Chromosome 3 (position 15598541)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15844142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACAGCGTTTGCATCTAGAGCCTTCTGTTGTTGTTTTGTTAGGTTTG[G/A]CAGGGGCTGGATGTGGTGAAGACGGCCAGAAAAATGCTTGGAGAGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link