arpc3

Ensembl ID:
ENSDARG00000057882
ZFIN ID:
ZDB-GENE-040625-107
Description:
actin-related protein 2/3 complex subunit 3 [Source:RefSeq peptide;Acc:NP_001002114]
Human Orthologue:
ARPC3
Human Description:
actin related protein 2/3 complex, subunit 3, 21kDa [Source:HGNC Symbol;Acc:706]
Mouse Orthologue:
Arpc3
Mouse Description:
actin related protein 2/3 complex, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1928375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6667 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080628 Nonsense 58 178 3 7
Genomic Location:
Chromosome 21 (position 15536438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYGATGAGGCCATTTACTACTTCAAAGCCAATGTTTTCTTCAAGAACTA[T/A]GAAATAAAGGTAAGGAGCAAATGACCGYGCTGGAAGCGTGAAGGAGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3qzg9rbz