lasp1

Ensembl ID:
ENSDARG00000057867
ZFIN ID:
ZDB-GENE-030131-1936
Description:
LIM and SH3 domain protein 1 [Source:RefSeq peptide;Acc:NP_997801]
Human Orthologue:
LASP1
Human Description:
LIM and SH3 protein 1 [Source:HGNC Symbol;Acc:6513]
Mouse Orthologue:
Lasp1
Mouse Description:
LIM and SH3 protein 1 Gene [Source:MGI Symbol;Acc:MGI:109656]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5191 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051807 Nonsense 33 234 2 7
ENSDART00000064838 Nonsense 11 212 2 7

The following transcripts of ENSDARG00000057867 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 15725685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCYATGTCTCTCTTTTTCAGTACTGGCATAAAGGATGCTTTAGCTGT[G/T]AAGTCTGTAAGATGACTCTAAACATGAAGAACTACAAAGGCTTYGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vhpm12h5