dnmt5

Ensembl ID:
ENSDARG00000057863
ZFIN ID:
ZDB-GENE-050314-2
Description:
DNA methyltransferase dnmt5 [Source:RefSeq peptide;Acc:NP_001018315]
Human Orthologue:
DNMT3B
Human Description:
DNA (cytosine-5-)-methyltransferase 3 beta [Source:HGNC Symbol;Acc:2979]
Mouse Orthologue:
Dnmt3b
Mouse Description:
DNA methyltransferase 3B Gene [Source:MGI Symbol;Acc:MGI:1261819]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1138 Essential Splice Site F2 line generated During 2017
sa10487 Nonsense Available for shipment Available now
sa43934 Nonsense Mutation detected in F1 DNA During 2017
sa32435 Nonsense Available for shipment Available now
sa37657 Essential Splice Site Available for shipment Available now
sa24282 Nonsense Available for shipment Available now
sa43933 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43932 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37656 Nonsense Mutation detected in F1 DNA During 2017
sa14033 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1138
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889   None 1296 None 24
ENSDART00000121730   None 1289 None 22
ENSDART00000125472 Essential Splice Site None 399 2 4
ENSDART00000142297 Essential Splice Site None 1296 2 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17151619)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17054558
KASP Assay ID:
554-1049.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTAATTCAGTAACAGACCAGTCTAGTGGAGTACATCACCTGCTCAGG[T/C]ATTGTTTTTTTAGTGTTTTTCTTTTTCAGATGTCTAAAACACCTTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Nonsense 309 1296 3 24
ENSDART00000121730 Nonsense 309 1289 1 22
ENSDART00000125472 Nonsense 309 399 4 4
ENSDART00000142297 Nonsense 309 1296 4 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17149900)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17052839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGCGTCTTACAACTGCTCCAAGATGCTTCTAAATTATTGAGGCTTTA[C/A]ACACAGAGTTTCCTCAGACCAAAAGCAGCAGAGTATTTTCACAGGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Nonsense 348 1296 3 24
ENSDART00000121730 Nonsense 348 1289 1 22
ENSDART00000125472 Nonsense 348 399 4 4
ENSDART00000142297 Nonsense 348 1296 4 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17149785)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17052724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGGAGACAGTGGGACATTTACCTAGAGGAGAGGTTGCAGTCGGCGAA[C/T]AGGCTGCTGATTTTCTCCAGCAGCACTCTGAAGAGTTGTCTGACTACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Nonsense 635 1296 8 24
ENSDART00000121730 Nonsense 627 1289 7 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Nonsense 635 1296 9 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17144726)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17047665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCATTTTATTTCTTCAGGGCAGTTACATAGTCGGTGAGATGGTTTGG[G/T]GACCGCTTGAAGGCTTTGGTCTTTGGCCTGGATTGGTTCAGAGCTGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Essential Splice Site 896 1296 13 24
ENSDART00000121730 Essential Splice Site 888 1289 12 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Essential Splice Site 896 1296 14 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17142237)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17045176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATTATCCACCCACTGTTCGAAGGAAGCCTGTGTGTGAAATGCAAGG[T/A]AAAACTGCCATAAACATAGTTCCGCAAAATAAAATGATCCAGACAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Nonsense 911 1296 14 24
ENSDART00000121730 Nonsense 903 1289 13 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Nonsense 911 1296 15 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17138243)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17041182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATAGTTTAATTTCACGGAGACGCTGTACAGATATGATGAAGATGGCTA[T/A]CAGTCGTACTGCACCGTCTGCTGTTCTGGCATGGAGGTCATTCTGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Essential Splice Site 934 1296 14 24
ENSDART00000121730 Essential Splice Site 926 1289 13 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Essential Splice Site 934 1296 15 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17138173)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17041112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTCTGGCATGGAGGTCATTCTGTGTGGTCATGACAGCTGCTGTCGG[T/G]AAGTGTGTTTGTGGTGGTCACGAAGAAACCCAGGACAACTAAACCATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Essential Splice Site 1103 1296 18 24
ENSDART00000121730 Essential Splice Site 1095 1289 17 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Essential Splice Site 1103 1296 19 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17135173)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17038112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGTAATGACTTGTGCACAGTCAATCCTGGCCGTAAAGGCTTGTTTGG[T/C]AAGACAAATCTGTTGCACTTTACACACAATATGATTTGCCTGGCATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Nonsense 1119 1296 19 24
ENSDART00000121730 Nonsense 1111 1289 18 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Nonsense 1119 1296 20 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17134886)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17037825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGGCTCTGGACGGCTGTTTTTTGAGTACTACCGGCTTCTGAACGTTT[T/A]GAAGCCGAAAGAGGATGACCCACGGCCCTTCTTCTGGCTCTTTGAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046889 Nonsense 1196 1296 21 24
ENSDART00000121730 Nonsense 1189 1289 20 22
ENSDART00000125472   None 399 None 4
ENSDART00000142297 Nonsense 1196 1296 22 24
ENSDART00000143180   None 216 None 3

The following transcripts of ENSDARG00000057863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17132773)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17035712
KASP Assay ID:
2261-7492.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAGACCAAWCATAGCATCACAGAAAGATAAAGTCAGTCTTCAGGACTG[T/A]CTGGATGGAGGCCGCACTGCCAAGGTTTGTCATGASCTTYCTACTAAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link