hoxd10a

Ensembl ID:
ENSDARG00000057859
ZFIN ID:
ZDB-GENE-990415-116
Description:
Homeobox protein Hox-D10a [Source:UniProtKB/Swiss-Prot;Acc:Q90469]
Human Orthologue:
HOXD10
Human Description:
homeobox D10 [Source:HGNC Symbol;Acc:5133]
Mouse Orthologue:
Hoxd10
Mouse Description:
homeobox D10 Gene [Source:MGI Symbol;Acc:MGI:96202]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13761 Nonsense Available for shipment Available now
sa21418 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080608 Nonsense 88 332 1 2
ENSDART00000130837 Nonsense 88 341 1 4
Genomic Location:
Chromosome 9 (position 1960471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCGTACATACCTCAAACTRATACCTGGGCAGATCCGAGYAGGTCCTGC[C/T]GRTTAGAGCAACCRCTCAACCAGATGTCCRCCTGCACATTTTCACAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080608 Essential Splice Site 241 332 1 2
ENSDART00000130837 Essential Splice Site 241 341 1 4
Genomic Location:
Chromosome 9 (position 1960008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAGGCGTCTGTTTCCAGCCCCGAATTGCCACACAGAGAAGGCAAAG[G/A]TGGGTACAATAAACGGATTAATCGCGTCTTGGTGTAATGCGAACGCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h0fgv1ia