LOC100006392

Ensembl ID:
ENSDARG00000057833
Human Orthologue:
GULP1
Human Description:
GULP, engulfment adaptor PTB domain containing 1 [Source:HGNC Symbol;Acc:18649]
Mouse Orthologue:
Gulp1
Mouse Description:
GULP, engulfment adaptor PTB domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1920407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1778 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080589 Nonsense 130 399 6 12
Genomic Location:
Chromosome 6 (position 11423863)
KASP Assay ID:
554-1771.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGTTTCTCCTCAACTCTCTTTCCTGTTCCAGGASATGCTGCACAACTG[C/A]CAGCTTCACAGAATGTCCTTCTGTGCAGACGACAAAACAGATAAAAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nuc03vom