dnmt3

Ensembl ID:
ENSDARG00000057830
ZFIN ID:
ZDB-GENE-990712-11
Description:
DNA (cytosine-5-)-methyltransferase 3 [Source:RefSeq peptide;Acc:NP_571461]
Human Orthologue:
DNMT3B
Human Description:
DNA (cytosine-5-)-methyltransferase 3 beta [Source:HGNC Symbol;Acc:2979]
Mouse Orthologue:
Dnmt3b
Mouse Description:
DNA methyltransferase 3B Gene [Source:MGI Symbol;Acc:MGI:1261819]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24284 Nonsense Available for shipment Available now
sa43937 Nonsense Mutation detected in F1 DNA During 2017
sa43936 Nonsense Mutation detected in F1 DNA During 2017
sa14072 Nonsense Available for shipment Available now
sa37658 Nonsense Mutation detected in F1 DNA During 2017
sa9741 Nonsense Available for shipment Available now
sa24283 Essential Splice Site Available for shipment Available now
sa43935 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 153 1448 4 24
ENSDART00000126841 Nonsense 153 1448 5 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17169993)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17072932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTATTTTCTTTATTCATAGTTGAAAAGGAAAATGTGTCAAGCCTCTA[C/A]AATACTGAAGAAACCAGTTCAAACCAGAAAACGCAACATGTTGAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 650 1448 5 24
ENSDART00000126841 Nonsense 650 1448 6 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17168364)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17071303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTGTGTGTAATAATCTATATTTCAGATGTTTCAACAAACTGACTA[T/G]CTCAAGATGATGAGAAAAGAGGACTGTGAGGAGAAGGATATGATGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 762 1448 7 24
ENSDART00000126841 Nonsense 762 1448 8 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17167838)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17070777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGATGATGATGATGAAATGACAGATGATGATGACGATTATGGCTGT[G/T]AAGCTGGCGAAGTCATGTGGAAGTATTCGGTAAATATTTTCCCATTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 770 1448 7 24
ENSDART00000126841 Nonsense 770 1448 8 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17167812)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17070751
KASP Assay ID:
2261-7500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATGATGACGATTATGGCTGTGAAGCTGGCGAAGTCATGTGGAAGTA[T/A]TCGGTAAATATTTTCCCATTGGTTTTATGTTTTAAGTTTATTTCTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 862 1448 10 24
ENSDART00000126841 Nonsense 862 1448 11 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17162823)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17065762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTAGCCAAGTGCTTTTGTTCTAATTCCTTCGCTACAGTAATGGCATA[T/G]AAAGATGCAATTTTCAGTTCTCTGCAGGTAAGGCAAATTCTGTTTCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 984 1448 12 24
ENSDART00000126841 Nonsense 984 1448 13 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17160480)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17063419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAATGGAATGGCAGATCAATGCAGACMGTTAAGATCCGTAGAAAATA[T/G]AAACAGCGGAATAAGAATATCATCCCAACTGTACAGATCGAGTCCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Essential Splice Site 1255 1448 19 24
ENSDART00000126841 Essential Splice Site 1255 1448 20 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17157459)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17060398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTAATGACTTGTCCATAGTCAATCCTGCTCGGAAAGGCTTGTATGG[T/G]AAGACAAAAGTACTGAAAGACAAAGTTCAAGCATTAAATCATAAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080545 Nonsense 1357 1448 23 24
ENSDART00000126841 Nonsense 1357 1448 24 25

The following transcripts of ENSDARG00000057830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17154762)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17057701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAATGATGTCACAGTGGTCGTAACACTGAAATGTACTATTTTCCAGTA[T/A]GAAAAAGTTCGCACTATCACTACACGGCAAAACTCCCTGAAGCAGGGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link