NP_001128609.1

Ensembl ID:
ENSDARG00000057827
Description:
CD4-2 protein [Source:RefSeq peptide;Acc:NP_001128609]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14406 Nonsense Available for shipment Available now
sa22771 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103970 Nonsense 41 296 3 9
ENSDART00000131202 Nonsense 46 383 3 9
Genomic Location (Zv9):
Chromosome 16 (position 13703463)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12062554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGGTTATTTTGCAGTGTGGAGCAYCTCCAAATAGTGAYATAGARTG[G/A]AGGTTAAACAACATTCKCTTAATCAGCATTAMCGGCAAAWCTGGATTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103970 Nonsense 72 296 4 9
ENSDART00000131202 Nonsense 77 383 4 9
Genomic Location (Zv9):
Chromosome 16 (position 13703294)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12062385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTATTGTTTTAAAGGTTCTGGCCATTCTGTGGACAAAGTAAATTTATA[T/A]GGAGACACTCTAAAGATTCCCAGACTGGAGCCAAGAGACTCTGGAGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link