si:ch73-61d6.3

Ensembl ID:
ENSDARG00000057826
ZFIN ID:
ZDB-GENE-091204-109
Human Orthologue:
OCLN
Human Description:
occludin [Source:HGNC Symbol;Acc:8104]
Mouse Orthologue:
Ocln
Mouse Description:
occludin Gene [Source:MGI Symbol;Acc:MGI:106183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21222 Nonsense Available for shipment Available now
sa15722 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090541 Nonsense 280 534 2 12
ENSDART00000142224 Nonsense 91 343 2 7
Genomic Location (Zv9):
Chromosome 8 (position 13724466)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13169810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCTGGCTGTGGCGGCCTTTTTCTCCTACAGGACCAGAAGTAAGATCT[G/A]GCAGTATGGCAAACCAAACATCTACTGGGATCGACCTCTGATGGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090541 Nonsense 530 534 12 12
ENSDART00000142224 Nonsense 339 343 7 7
Genomic Location (Zv9):
Chromosome 8 (position 13707570)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13152914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAAACTGCGCCACAAGCTCTTCCATATTAAACGAATGGTCAAGAACTA[C/A]GACCGCCGTCAATAATGAGCTCCATYAAACCAGCACCTGTTYTCCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link