lratb

Ensembl ID:
ENSDARG00000057813
ZFIN IDs:
ZDB-GENE-030131-9581, ZDB-GENE-060810-31
Description:
Lratb protein [Source:UniProtKB/TrEMBL;Acc:Q5EAQ3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1600 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080576 Nonsense 132 231 1 2
ENSDART00000131090 None None 699 None 20
Genomic Location:
Chromosome 1 (position 9286699)
KASP Assay ID:
554-1541.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTTCGCCTACGGGTCCAATATTTTGCTGAACACGATGGACACTACCT[T/A]GAGAAAACAGCCGCTGGCTGCTGAGGAGGTCGCCAGAAGAGCCGAAAAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ymflwqce