cx52.7

Ensembl ID:
ENSDARG00000057792
ZFIN ID:
ZDB-GENE-050616-15
Description:
connexin 52.7 [Source:RefSeq peptide;Acc:NP_001106974]
Human Orthologues:
GJA10, GJA9
Human Descriptions:
gap junction protein, alpha 10, 62kDa [Source:HGNC Symbol;Acc:16995]
gap junction protein, alpha 9, 59kDa [Source:HGNC Symbol;Acc:19155]
Mouse Orthologue:
Gja10
Mouse Description:
gap junction protein, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:1339969]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124045 Nonsense 138 471 1 2
Genomic Location (Zv9):
Chromosome 17 (position 15587704)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15738532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGCCCCTCTTGGAGGAGCACAGAAAGTTGGAGAAGGAACTGAGGAGGT[T/A]GGAAGAGCAGAAGAAGATGAAGAAGGCTCCTCTAAGGGGCTCCTTGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link