ANKRD6 (2 of 2)

Ensembl ID:
ENSDARG00000057790
Description:
ankyrin repeat domain 6 [Source:HGNC Symbol;Acc:17280]
Human Orthologue:
ANKRD6
Human Description:
ankyrin repeat domain 6 [Source:HGNC Symbol;Acc:17280]
Mouse Orthologue:
Ankrd6
Mouse Description:
ankyrin repeat domain 6 Gene [Source:MGI Symbol;Acc:MGI:2154278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23030 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080526 Nonsense 668 691 14 14
Genomic Location:
Chromosome 17 (position 15598636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGGAGACACAGAGATCCGCAGAACATAAAGCTCTGCAGGACAGAAGC[A/T]GACTGATGGAGAAGATCAGCTCGCTGGAGGAAGAGCTCAGGAGGCTTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j8p4gwpx