ITGAE

Ensembl ID:
ENSDARG00000057787
Description:
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) [Source:HGN
Human Orthologue:
ITGAE
Human Description:
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) [Source:HGN
Mouse Orthologue:
Itgae
Mouse Description:
integrin alpha E, epithelial-associated Gene [Source:MGI Symbol;Acc:MGI:1298377]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16148 Nonsense Available for shipment Available now
sa22611 Nonsense Mutation detected in F1 DNA During 2014
sa12794 Nonsense Available for shipment Available now
sa22610 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 189 1266 7 35
Genomic Location:
Chromosome 15 (position 16229641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAYTTTCAGAAAGCGAAAGACTTCATCTACAATGTCATGTCCAATGTTT[G/A]GAAAACATGTTTCGATGCAAGTATAAAGAAAAAAAAANNNTCATGGCACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 288 1266 9 35
Genomic Location:
Chromosome 15 (position 16229185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGAGACCCTATGACTCTTGATGAAGTTTTGAACAAGCCCCAAATG[A/T]AAGGTGTCACTCGCTACTCCATAGGGGTAAGTGTCCCATTTACTGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 916 1266 23 35
Genomic Location:
Chromosome 15 (position 16199257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTGCTTTGATTGTTTTTCACCTATTAAAATCAAGCTGAGTTTTTCAT[T/A]GGCATCMWACAAAAATGAAGCACCTATTCGCATTCTTGATGCATTTACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Essential Splice Site 1005 1266 26 35
Genomic Location:
Chromosome 15 (position 16197505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACAGTTGCATTTAACAGAGAGTCCTGACGAACTGTGCTCTGCAAAC[A/C]GAAAATTGAAGGAGCCGCCTGTCCTGTGAAGAATGACAATCAGATTCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ys9p2o3p