A3KP78_DANRE

Ensembl ID:
ENSDARG00000057782
Description:
LOC100148397 protein [Source:UniProtKB/TrEMBL;Acc:A3KP78]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20663 Nonsense Mutation detected in F1 DNA During 2016
sa40645 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080539 Nonsense 25 312 3 7
Genomic Location (Zv9):
Chromosome 6 (position 11828261)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11681887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCCTTCCGCCACCCCGGCCTCCGTCCACACCGCCACCTCAGTGTCAT[C/A]ATCTTCCTCTTCCTCCTCTTCCTCATCCACAGCAGCCTCCAATGCCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080539 Nonsense 242 312 6 7
Genomic Location (Zv9):
Chromosome 6 (position 11850982)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11704608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCAACAGCACAGGGGAGCTTCAGGAGAAACCCTCGCAGAAAACTAAA[G/T]AGAAGGTGTGACAGCACTGAACGCCATCCGTCTAAACACACAAAACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link