march7

Ensembl ID:
ENSDARG00000057772
ZFIN IDs:
ZDB-GENE-080204-121, ZDB-GENE-080204-121
Description:
E3 ubiquitin-protein ligase MARCH7 [Source:RefSeq peptide;Acc:NP_001108052]
Human Orthologue:
MARCH7
Human Description:
membrane-associated ring finger (C3HC4) 7 [Source:HGNC Symbol;Acc:17393]
Mouse Orthologue:
March7
Mouse Description:
membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI Symbol;Acc:MGI:1931053]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3597 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10385 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Essential Splice Site None 179 None 15
ENSDART00000126243 Essential Splice Site 61 768 None 11
ENSDART00000129198 Essential Splice Site None 179 None 9
Genomic Location:
Chromosome 6 (position 11711170)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCGCTTTAGCAGAGACGCTTCTGTCAAATTAGACTCTGACTATCAGG[T/A]ATTACAGTGACACATTCATTTCCCGACTCTGTCCACATGCCCGGGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Nonsense 54 179 6 15
ENSDART00000126243 Nonsense 594 768 6 11
ENSDART00000129198 Nonsense 54 179 6 9
Genomic Location:
Chromosome 6 (position 11698753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCTTTTGTGTATCGACCTCACATTGCTTCTTGCTTTTAGCCTGCTGT[T/A]GGAGGAATCTGATGAGGARGAGGGTGATCTGTGCCGAATCTGTCAGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/60769jp4