march7

Ensembl ID:
ENSDARG00000057772
ZFIN IDs:
ZDB-GENE-080204-121, ZDB-GENE-080204-121
Description:
E3 ubiquitin-protein ligase MARCH7 [Source:RefSeq peptide;Acc:NP_001108052]
Human Orthologue:
MARCH7
Human Description:
membrane-associated ring finger (C3HC4) 7 [Source:HGNC Symbol;Acc:17393]
Mouse Orthologue:
March7
Mouse Description:
membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI Symbol;Acc:MGI:1931053]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30623 Nonsense Mutation detected in F1 DNA During 2016
sa40644 Nonsense Mutation detected in F1 DNA During 2016
sa10385 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366   None 179 5 15
ENSDART00000126243 Nonsense 235 768 5 11
ENSDART00000129198   None 179 5 9
Genomic Location (Zv9):
Chromosome 6 (position 11703065)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11556691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTTCTTTTTGTGCTTCAGATCGTTCAGAACGTGTTGCTTCTACCTA[T/A]GCACAAGGTGCTCGACCCAAAGATAGCCAGTACTCGTCCCACAGAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Nonsense 27 179 5 15
ENSDART00000126243 Nonsense 567 768 5 11
ENSDART00000129198 Nonsense 27 179 5 9
Genomic Location (Zv9):
Chromosome 6 (position 11702071)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11555697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTTTGCCTGAGAATGTGTTGATTGGTGTTGGAGTCGAGGGGAGGAGT[C/T]AAGCTGATGAGCAGCCCAAAGACAAGCCTGCCCCATCCAGAGACCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Nonsense 54 179 6 15
ENSDART00000126243 Nonsense 594 768 6 11
ENSDART00000129198 Nonsense 54 179 6 9
Genomic Location (Zv9):
Chromosome 6 (position 11698753)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11552379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCTTTTGTGTATCGACCTCACATTGCTTCTTGCTTTTAGCCTGCTGT[T/A]GGAGGAATCTGATGAGGARGAGGGTGATCTGTGCCGAATCTGTCAGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link