plp1a

Ensembl ID:
ENSDARG00000057770
ZFIN ID:
ZDB-GENE-001202-1
Description:
proteolipid protein 1a [Source:RefSeq peptide;Acc:NP_783166]
Human Orthologue:
PLP1
Human Description:
proteolipid protein 1 [Source:HGNC Symbol;Acc:9086]
Mouse Orthologue:
Plp1
Mouse Description:
proteolipid protein (myelin) 1 Gene [Source:MGI Symbol;Acc:MGI:97623]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42372 Nonsense Mutation detected in F1 DNA During 2017
sa42373 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080522 Nonsense 73 245 3 7
Genomic Location (Zv9):
Chromosome 14 (position 18482758)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14277211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTCTTTCTCTCTTTTATAGTATTGAGTATTTCCAGTACATTATCTA[C/A]GGCCTGGCCTCCTTCTTTTTCTTATACTGTATAGTCCTGCTGGCTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080522 Nonsense 150 245 4 7
Genomic Location (Zv9):
Chromosome 14 (position 18485845)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14280298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTCTGCATTTCCTGTATATTTTTTCTACAACATGGCCAAAACCTGT[C/T]AAACTATCAATTTCCTTTCTGAAACGCCCTCCAGCATCAACCAGCTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link