si:dkey-10f21.3

Ensembl ID:
ENSDARG00000057769
ZFIN ID:
ZDB-GENE-070912-349

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39790 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080500   None 258 None 5
ENSDART00000137546 Nonsense 12 336 2 7
Genomic Location (Zv9):
Chromosome 2 (position 14814168)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15324995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAATAATCAGTGTTTGCTGTCTGTGATATTTCATCTTCAGGCCGCTCC[A/T]GATCCAGGAGTGCAGCTTTCACCCAGACAGCAGTTCAGGACACAGAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link