RBMS1 (2 of 2)

Ensembl ID:
ENSDARG00000057768
Description:
RNA binding motif, single stranded interacting protein 1 [Source:HGNC Symbol;Acc:9907]
Human Orthologue:
RBMS1
Human Description:
RNA binding motif, single stranded interacting protein 1 [Source:HGNC Symbol;Acc:9907]
Mouse Orthologue:
Rbms1
Mouse Description:
RNA binding motif, single stranded interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1861774]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21605 Nonsense Available for shipment Available now
sa34774 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025530 Nonsense 156 338 5 12
Genomic Location (Zv9):
Chromosome 9 (position 53109746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGTTTGCGGACGGAGGCCAGAAGAAGCGGCAGAGTCAAAATAAATA[T/A]GTGCAGAACGGCCGAGGCTGGGGCCGAGATGGAGAGAGCAGACTGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025530 Essential Splice Site 188 338 6 12
Genomic Location (Zv9):
Chromosome 9 (position 53111864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCATGACCCTCACATACGATCCCACCACAGCTGCTATGCAAAATGG[G/A]TAAGAGCATCTGTTGTTTTAGCTTTACTTATGTATTATTGTAGTTTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link