si:ch211-145c23.4

Ensembl ID:
ENSDARG00000057751
ZFIN ID:
ZDB-GENE-081104-121
Description:
Novel zinc finger protein [Source:UniProtKB/TrEMBL;Acc:B8JL75]
Human Orthologue:
ZBTB47
Human Description:
zinc finger and BTB domain containing 47 [Source:HGNC Symbol;Acc:26955]
Mouse Orthologue:
Zfp651
Mouse Description:
zinc finger protein 651 Gene [Source:MGI Symbol;Acc:MGI:2670992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32896 Nonsense Mutation detected in F1 DNA During 2017
sa30816 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080495 Nonsense 139 671 2 6
ENSDART00000141322   None 381 None 5
Genomic Location (Zv9):
Chromosome 2 (position 21108285)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21654223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCTCCAGATGAGCAACATTGCTACATCCTGCAGCGAACTCATCTCC[C/T]GAGGCTCGGTGGAGATCAGTGTCAAAGATCAGCAAAACAAACCTGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080495 Nonsense 330 671 2 6
ENSDART00000141322 Nonsense 111 381 1 5
Genomic Location (Zv9):
Chromosome 2 (position 21108858)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21654796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGGCCTCTGCTCCACTGGTCTCCAAGAGGAGCTGTGCGAGAGCAAGG[C/T]AAGAGACGGATCGTGATCCTAGCGAGGAACGTCTGGATCAGGACGGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link