LOC100332111

Ensembl ID:
ENSDARG00000057731
Human Orthologue:
SHC3
Human Description:
SHC (Src homology 2 domain containing) transforming protein 3 [Source:HGNC Symbol;Acc:18181]
Mouse Orthologue:
Shc3
Mouse Description:
src homology 2 domain-containing transforming protein C3 Gene [Source:MGI Symbol;Acc:MGI:106179]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37208 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43564 Nonsense Mutation detected in F1 DNA During 2016
sa12302 Essential Splice Site Available for shipment Available now
sa23841 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080479 Essential Splice Site 21 374 1 9
Genomic Location (Zv9):
Chromosome 21 (position 3272320)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2941051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATCTCCACCAGCAGTTTAAACCTGATGACACCCGACTCTAAACAGG[T/C]TCACACACACACACGCACACACTGATCGTCTCTCTTTCAGGAGCCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080479 Nonsense 88 374 4 9
Genomic Location (Zv9):
Chromosome 21 (position 3262815)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2950466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCAGTACGATCGGTCAGGCGTTTGACCTGCGCTTTCAGCTCTACCTG[C/T]AGTGTCCCTCCAGCAAACCCTCGTCCATTCACGACAGGTGAGTTCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080479 Essential Splice Site 168 374 7 9
Genomic Location (Zv9):
Chromosome 21 (position 3255140)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2958141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATSAGACTGTTTCAGATTGAAACWTCTTCTGTCTGTGTGTCTTTTATTTA[G/A]GGTCRTGTGACATCTACAGTCTCCCTGAGGTCAAAGCTCAGCCTYYTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080479 Nonsense 365 374 9 9
Genomic Location (Zv9):
Chromosome 21 (position 3249416)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2963865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACCGTGACAACAACCTGCCAATCGTGTCTGCGGGCAGTGAACTGTG[T/A]TTGAAGCAGCCGGTGGACAGAAAACAGTGACGAAAACTGGTGCCACTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to statin therapy (LDL-C): Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link