LOC100332111

Ensembl ID:
ENSDARG00000057731
Human Orthologue:
SHC3
Human Description:
SHC (Src homology 2 domain containing) transforming protein 3 [Source:HGNC Symbol;Acc:18181]
Mouse Orthologue:
Shc3
Mouse Description:
src homology 2 domain-containing transforming protein C3 Gene [Source:MGI Symbol;Acc:MGI:106179]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12302 Essential Splice Site Available for shipment Available now
sa23841 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080479 Essential Splice Site 168 374 7 9
Genomic Location:
Chromosome 21 (position 3255140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATSAGACTGTTTCAGATTGAAACWTCTTCTGTCTGTGTGTCTTTTATTTA[G/A]GGTCRTGTGACATCTACAGTCTCCCTGAGGTCAAAGCTCAGCCTYYTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080479 Nonsense 365 374 9 9
Genomic Location:
Chromosome 21 (position 3249416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACCGTGACAACAACCTGCCAATCGTGTCTGCGGGCAGTGAACTGTG[T/A]TTGAAGCAGCCGGTGGACAGAAAACAGTGACGAAAACTGGTGCCACTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to statin therapy (LDL-C): Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6uwahggx