nsdhl

Ensembl ID:
ENSDARG00000057723
ZFIN ID:
ZDB-GENE-050417-163
Description:
sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating [Source:RefSeq peptide;Acc:NP_001017674
Human Orthologue:
NSDHL
Human Description:
NAD(P) dependent steroid dehydrogenase-like [Source:HGNC Symbol;Acc:13398]
Mouse Orthologue:
Nsdhl
Mouse Description:
NAD(P) dependent steroid dehydrogenase-like Gene [Source:MGI Symbol;Acc:MGI:1099438]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35671 Essential Splice Site Available for shipment Available now
sa35670 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080458 Essential Splice Site None 345 None 8
ENSDART00000139971   None 201 1 6
ENSDART00000142405   None 185 1 5
Genomic Location (Zv9):
Chromosome 14 (position 18559004)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14353457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCGCCCAGTATCAATAAAGCTGTAACTCTTGTCCAAGTTTTTCAGG[T/C]GAGTGTTGCTTAAATTCTTTTTACAAAAATTAGAAAAAGTAATTTCTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080458 Nonsense 269 345 8 8
ENSDART00000139971   None 201 None 6
ENSDART00000142405   None 185 None 5
Genomic Location (Zv9):
Chromosome 14 (position 18547218)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14341671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTCTGGTTGGCCTGGGCTACAGCGCTCCACGATACCACCTGCCCTA[T/A]GCGCTGGTCTATGGGATAGCTCTGCTGCTGTGGTTTATTTCCCTCATACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link