ogt.1

Ensembl ID:
ENSDARG00000057702
ZFIN ID:
ZDB-GENE-030131-9631
Description:
O-linked N-acetylglucosamine transferase isoform 1 [Source:RefSeq peptide;Acc:NP_001017359]
Human Orthologue:
OGT
Human Description:
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylgluco
Mouse Orthologue:
Ogt
Mouse Description:
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylgluco

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18601 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054556 Nonsense 227 1052 6 23
ENSDART00000080383 Nonsense 237 1062 6 23
ENSDART00000080496 Nonsense 237 1046 6 22
ENSDART00000122502 Nonsense 227 1036 6 22

The following transcripts of ENSDARG00000057702 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 18638527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCCAAACTTTTTGGATGCTTACAWCAACTTGGGTAATGTTCTGAAA[G/T]AGGCTCGTATCTTTGACAGGTAAAGGGTCACTTCTTCTATCATTATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ngiyz8dl