ogt.1

Ensembl ID:
ENSDARG00000057702
ZFIN ID:
ZDB-GENE-030131-9631
Description:
O-linked N-acetylglucosamine transferase isoform 1 [Source:RefSeq peptide;Acc:NP_001017359]
Human Orthologue:
OGT
Human Description:
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylgluco
Mouse Orthologue:
Ogt
Mouse Description:
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylgluco

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18601 Nonsense Available for shipment Available now
sa42376 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054556 Nonsense 227 1052 6 23
ENSDART00000080383 Nonsense 237 1062 6 23
ENSDART00000080496 Nonsense 237 1046 6 22
ENSDART00000122502 Nonsense 227 1036 6 22

The following transcripts of ENSDARG00000057702 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 18638527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCCAAACTTTTTGGATGCTTACAWCAACTTGGGTAATGTTCTGAAA[G/T]AGGCTCGTATCTTTGACAGGTAAAGGGTCACTTCTTCTATCATTATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054556 Essential Splice Site 430 1052 10 23
ENSDART00000080383 Essential Splice Site 440 1062 10 23
ENSDART00000080496 Essential Splice Site 440 1046 10 22
ENSDART00000122502 Essential Splice Site 430 1036 10 22
ENSDART00000054556 Essential Splice Site 430 1052 10 23
ENSDART00000080383 Essential Splice Site 440 1062 10 23
ENSDART00000080496 Essential Splice Site 440 1046 10 22
ENSDART00000122502 Essential Splice Site 430 1036 10 22

The following transcripts of ENSDARG00000057702 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 18633514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATCCTGCTTTTGCTGATGCTCACAGTAATTTGGCTTCCATACACAAAG[T/A]AAGAATCTGGAATAATACTCTTTGTTTAAAGTTGTTTTAGTGTTGTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link